ROUGE |
Gene/Protein Characteristic Table for mKIAA1974 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129470 |
---|---|
aminopeptidase-like 1. | |
mpk00325 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1284 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 448 bp Genome contig ID gi66880554f_173445470 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
TTCACTTGAAGTTGAATTAAATATGGCCACAACATFlanking genome sequence
(102140 - 102189) ----+----*----+----*----+----*----+----*----+----*
AACCTTGTCTCCGCTCACTTTTTTTCTCAACTTCTTTGTCTTACTTCTTT
KIAA Alignment based on: KIAA1974 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 387..836
Length: 149 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |