| HUGE |
Gene/Protein Characteristic Table for KIAA1963 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00959 |
|---|---|
| Accession No. : | AB075843 |
| Description : | Galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 2. |
| HUGO Gene Name : | |
| Clone Name : | ph00179 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1963
![]() |
| Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6031 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4450 bp Genome contig ID gi89161210r_71523637 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
GCTTGTTAATTCCAAATAAAGTTCTGTGAATCCTGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TACATGCCTCTTAATTTTTTAATTCTAATGCTCATTCATTTCGGCTTCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 71623637 71723462 4 99.2 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 488 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : AACACCTATAGTCTGGAGCTC | |
| : ATCCACGACGCTTAAATACAG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |