HUGE |
Gene/Protein Characteristic Table for KIAA1960 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00957 |
---|---|
Accession No. : | AB075840 |
Description : | Protein Shroom1. |
HUGO Gene Name : | shroom family member 1 (SHROOM1) |
Clone Name : | hk03842 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1960
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4017 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 653 bp Genome contig ID gi51511721r_132085734 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
CAGCCTATTTTTTCTTCAATAAAAATTGTTAAGAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAGTGTGTGTGTCATCTGCAGCACAGCTGTGGGAGGAGTGAGAGGGGTCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 5 r 132185734 132194489 10 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 871 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR014800 | 126 | 292 | PF08688 | Apx/shroom |
IPR014799 | 566 | 843 | PF08687 | Apx/shroom |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TCTATGTGACCCTCTTGCTTC | |
: GGGTGAAGCTGAACTGATAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 5 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |