HUGE

Gene/Protein Characteristic Table for KIAA1481

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06827
Accession No. :	AB040914
Description :	Protein Shroom3.
HUGO Gene Name :	shroom family member 3 (SHROOM3)
Clone Name :	fj05724 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4755 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 612 bp

Genome contig ID gi89161207f_77780199
PolyA signal sequence
(AATGAA,-16)
+----*----+----*----+----*----+----
TTTGTGAAAACCTTAATGAAATGAATTCCAAAGAT
Flanking genome sequence
(139769 - 139818)
----+----*----+----*----+----*----+----*----+----*
AGTCACGTTGAGCGTGAAGACTTTTTTTCTTACATTCCTGTCTTATTTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 77880199 77919966 7 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1380 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8TF72	100.0	Protein Shroom3...	Homo sapiens
EAX05795	100.0	shroom, isoform...	Homo sapiens
BAG54709	99.9	unnamed protein...	Homo sapiens
AAI56133	99.9	Shroom family m...	synthetic construct
NP_065910	99.9	shroom family m...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033028	3.8e-15	25.6	KIAA1202
AB075840	3.4e-06	23.4	KIAA1960

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014800 267 450 PF08688 Apx/shroom

IPR014799 1057 1340 PF08687 Apx/shroom

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014800	267	450	PF08688	Apx/shroom
IPR014799	1057	1340	PF08687	Apx/shroom

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGATGTTCATAGGGGATTTGG

Primer_r
: TTCACCAAGGCCGCTAAGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: CCR
Primer_f	: GGATGTTCATAGGGGATTTGG
Primer_r	: TTCACCAAGGCCGCTAAGGAC
PCR product length	: 98 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	612 bp
Genome contig ID	gi89161207f_77780199
PolyA signal sequence (AATGAA,-16)	+--------+--------+----*----+---- TTTGTGAAAACCTTAATGAAATGAATTCCAAAGAT
Flanking genome sequence (139769 - 139818)	----+--------+--------+--------+--------+----* AGTCACGTTGAGCGTGAAGACTTTTTTTCTTACATTCCTGTCTTATTTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	77880199	77919966	7	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1481

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information