HUGE

Gene/Protein Characteristic Table for KIAA1949

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00952
Accession No. :	AB075829
Description :
HUGO Gene Name :
Clone Name :	fj02913 [Vector Info]
Flexi ORF Clone :	pF1KSDA1949
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4015 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 878 bp

Genome contig ID gi89161210r_30652199
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTTTTAACTTTCCATAATAAAATGGAGTTCTCTTC
Flanking genome sequence
(99948 - 99899)
----+----*----+----*----+----*----+----*----+----*
AACTCGTCTGCTTCTCCTTCTTTGGGAAAAAAAAAGGGTATGTGAGGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 30752147 30763069 3 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 662 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD38640	6.3e-175	99.8	putative protei...	Homo sapiens
Q5TM66	1.2e-169	96.9	Phostensin; Pro...	Macaca mulatta
CAD38613	5.1e-92	100.0	hypothetical pr...	Homo sapiens
BAC86229	2.6e-91	99.4	unnamed protein...	Homo sapiens
AAI61960	2.8e-66	75.6	RGD1309543 prot...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAAGATTCAGGGCAGACAGAC

Primer_r
: CTTGGATGACCTAGGATGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	878 bp
Genome contig ID	gi89161210r_30652199
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTTTTAACTTTCCATAATAAAATGGAGTTCTCTTC
Flanking genome sequence (99948 - 99899)	----+--------+--------+--------+--------+----* AACTCGTCTGCTTCTCCTTCTTTGGGAAAAAAAAAGGGTATGTGAGGGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	30752147	30763069	3	100.0	Perfect prediction

Primer_f	: GAAGATTCAGGGCAGACAGAC
Primer_r	: CTTGGATGACCTAGGATGCAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1949

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information