| HUGE |
Gene/Protein Characteristic Table for KIAA1937 |
|
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK07615 |
|---|---|
| Accession No. : | AB067524 |
| Description : | Forkhead-associated (Fragment). |
| HUGO Gene Name : | forkhead-associated (FHA) phosphopeptide binding domain 1 (FHAD1) |
| Clone Name : | fk04595 [Vector Info] |
| Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3515 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 1400 bp Genome contig ID gi89161185f_15440862 PolyA signal sequence
(AAGAAA,-18) +----*----+----*----+----*----+----
GCACTGGCTGAAAATGAAAGAAAACCTGCAGATTTFlanking genome sequence
(142781 - 142830) ----+----*----+----*----+----*----+----*----+----*
ACATAATCAGTCCACATGCATTATTCATGGCCTCCCTAGGCACACACAAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 15540851 15583641 16 99.8 Terminal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 704 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : TGCCAGGAGAAGAGGATCAAC | |
| : ACTTGGCTCCTGAGGTATGAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 1 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |