HUGE

Gene/Protein Characteristic Table for KIAA1929

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB067516
Description :	Rhophilin-1.
HUGO Gene Name :	rhophilin, Rho GTPase binding protein 1 (RHPN1)
Clone Name :	fj08985 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4729 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 2414 bp

Genome contig ID gi51511724f_144422542
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
ACGTGTTAATTTGGTTAATAAAACTGTGGATCAAG
Flanking genome sequence
(114991 - 115040)
----+----*----+----*----+----*----+----*----+----*
GAGGCCAGTAGGCACTAACTGGGGATGACAGGGTGGCAGCCCTGTCTGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 f 144522542 144537531 14 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 410 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW82256	6.4e-167	100.0	rhophilin, Rho ...	Homo sapiens
Q8TCX5	6.6e-156	97.0	Rhophilin-1; GT...	Homo sapiens
EAW82251	6.8e-147	89.3	rhophilin, Rho ...	Homo sapiens
AAH25767	1.7e-146	91.7	Rhophilin, Rho ...	Homo sapiens
EAW82255	1.6e-123	98.4	rhophilin, Rho ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040904	4.4e-19	33.2	KIAA1471

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000861 32 104 PF02185 HR1-like rho-binding repeat

IPR004328 105 394 PF03097 BRO1

HMMSmart IPR011072 32 95 SM00742 HR1 rho-binding repeat

ProfileScan IPR004328 105 390 PS51180 BRO1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000861	32	104	PF02185	HR1-like rho-binding repeat
IPR004328	105	394	PF03097	BRO1
HMMSmart	IPR011072	32	95	SM00742	HR1 rho-binding repeat
ProfileScan	IPR004328	105	390	PS51180	BRO1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTCACAGCCTATTACAACCAG

Primer_r
: TGGAGGGCACCGATGTTGAAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: "8,15"

Experimental conditions

Panel name	: CCR
Primer_f	: CTCACAGCCTATTACAACCAG
Primer_r	: TGGAGGGCACCGATGTTGAAG
PCR product length	: 170(280) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	YES

Length of 3'UTR	2414 bp
Genome contig ID	gi51511724f_144422542
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- ACGTGTTAATTTGGTTAATAAAACTGTGGATCAAG
Flanking genome sequence (114991 - 115040)	----+--------+--------+--------+--------+----* GAGGCCAGTAGGCACTAACTGGGGATGACAGGGTGGCAGCCCTGTCTGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	f	144522542	144537531	14	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA1929

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information