HUGE

Gene/Protein Characteristic Table for KIAA1926

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05394
Accession No. :	AB067513
Description :	Hyaluronan and proteoglycan link protein 4 precursor.
HUGO Gene Name :	hyaluronan and proteoglycan link protein 4 (HAPLN4)
Clone Name :	hh10052 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5409 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3069 bp

Genome contig ID gi42406306r_19126734
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
TCAAAAAATAAAAATAAGTAAATCTCCTCTTCCTC
Flanking genome sequence
(99823 - 99774)
----+----*----+----*----+----*----+----*----+----*
ATTCTTCTGACAGTCTGAAGAGGATCAATGGTTTGGATTGAATGCATCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 r 19226557 19245178 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q86UW8	9.6e-164	100.0	Hyaluronan and ...	Homo sapiens
XP_001115151	1e-161	98.8	similar to brai...	Macaca mulatta
XP_001115139	2.9e-161	98.8	similar to brai...	Macaca mulatta
EDL28779	1.9e-147	90.4	hyaluronan and ...	Mus musculus
Q80WM4	2.9e-147	90.6	Hyaluronan and ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87433	6.2e-05	39.4	KIAA0246

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000538 174 221 PD000918 Link

FPrintScan IPR000538 183 195 PR01265 Link

IPR000538 211 224 PR01265 Link

IPR000538 229 240 PR01265 Link

HMMPfam IPR013106 56 157 PF07686 Immunoglobulin V-set

IPR000538 172 277 PF00193 Link

IPR000538 283 374 PF00193 Link

HMMSmart IPR003599 63 171 SM00409 Immunoglobulin subtype

IPR003598 69 160 SM00408 Immunoglobulin subtype 2

IPR003596 73 155 SM00406 Immunoglobulin V-set

IPR000538 171 278 SM00445 Link

IPR000538 282 375 SM00445 Link

ProfileScan IPR007110 56 171 PS50835 Immunoglobulin-like

IPR000538 173 278 PS50963 Link

IPR000538 283 375 PS50963 Link

ScanRegExp IPR000538 195 240 PS01241 Link

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000538	174	221	PD000918	Link
FPrintScan	IPR000538	183	195	PR01265	Link
IPR000538	211	224	PR01265	Link
IPR000538	229	240	PR01265	Link
HMMPfam	IPR013106	56	157	PF07686	Immunoglobulin V-set
IPR000538	172	277	PF00193	Link
IPR000538	283	374	PF00193	Link
HMMSmart	IPR003599	63	171	SM00409	Immunoglobulin subtype
IPR003598	69	160	SM00408	Immunoglobulin subtype 2
IPR003596	73	155	SM00406	Immunoglobulin V-set
IPR000538	171	278	SM00445	Link
IPR000538	282	375	SM00445	Link
ProfileScan	IPR007110	56	171	PS50835	Immunoglobulin-like
IPR000538	173	278	PS50963	Link
IPR000538	283	375	PS50963	Link
ScanRegExp	IPR000538	195	240	PS01241	Link

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 16 AALGPGALWAAAWGVLLLTAP 36 PRIMARY 21

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	16	AALGPGALWAAAWGVLLLTAP	36	PRIMARY	21

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATGTCACTAGTTATGCAGAGC

Primer_r
: GCCAATGAGATGAGAAATGTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3069 bp
Genome contig ID	gi42406306r_19126734
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- TCAAAAAATAAAAATAAGTAAATCTCCTCTTCCTC
Flanking genome sequence (99823 - 99774)	----+--------+--------+--------+--------+----* ATTCTTCTGACAGTCTGAAGAGGATCAATGGTTTGGATTGAATGCATCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	r	19226557	19245178	12	100.0	Perfect prediction

Primer_f	: ATGTCACTAGTTATGCAGAGC
Primer_r	: GCCAATGAGATGAGAAATGTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1926

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information