HUGE

Gene/Protein Characteristic Table for KIAA1896

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00944
Accession No. :	AB067483
Description :	solute carrier family 25, member 25 isoform b.
HUGO Gene Name :	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 25 (SLC25A25)
Clone Name :	fk06388 [Vector Info]
Flexi ORF Clone :	pF1KSDA1896
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3712 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1800 bp

Genome contig ID gi89161216f_129793564
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TAAAGCAGCCTTCTAATAAAGTTGTTTCAAAGCTG
Flanking genome sequence
(117782 - 117831)
----+----*----+----*----+----*----+----*----+----*
ATCATGGAGCCAGTATTTTTCTGACGGGGGCCTGGGTGGTCTGGGGGTGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 129893564 129911344 11 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 568 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAH73135	2.6e-209	100.0	solute carrier ...	Homo sapiens
XP_001153081	1.9e-206	99.2	solute carrier ...	Pan troglodytes
XP_548442	2.4e-199	96.0	similar to solu...	Canis lupus fam...
AAH66998	1.4e-197	95.2	Slc25a25 protei...	Mus musculus
EAW87738	3.1e-176	99.3	solute carrier ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007915	5.9e-08	23.3	KIAA0446

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR002048 164 237 PD000012 Calcium-binding EF-hand

FPrintScan IPR002167 280 300 PR00928 Graves disease carrier protein

IPR002067 288 301 PR00926 Mitochondrial carrier protein

IPR002067 301 315 PR00926 Mitochondrial carrier protein

IPR002167 305 325 PR00928 Graves disease carrier protein

IPR002067 344 364 PR00926 Mitochondrial carrier protein

IPR002167 363 387 PR00928 Graves disease carrier protein

IPR002067 392 410 PR00926 Mitochondrial carrier protein

IPR002167 415 436 PR00928 Graves disease carrier protein

IPR002067 435 453 PR00926 Mitochondrial carrier protein

IPR002067 483 505 PR00926 Mitochondrial carrier protein

HMMPfam IPR002048 138 166 PF00036 Calcium-binding EF-hand

IPR002048 169 197 PF00036 Calcium-binding EF-hand

IPR001993 284 374 PF00153 Mitochondrial substrate carrier

IPR001993 378 467 PF00153 Mitochondrial substrate carrier

IPR001993 475 567 PF00153 Mitochondrial substrate carrier

HMMSmart IPR002048 138 166 SM00054 Calcium-binding EF-hand

IPR002048 169 197 SM00054 Calcium-binding EF-hand

ProfileScan IPR002048 134 164 PS50222 Calcium-binding EF-hand

IPR002048 165 200 PS50222 Calcium-binding EF-hand

IPR002048 225 248 PS50222 Calcium-binding EF-hand

IPR001993 283 369 PS50920 Mitochondrial substrate carrier

IPR001993 377 462 PS50920 Mitochondrial substrate carrier

IPR001993 474 562 PS50920 Mitochondrial substrate carrier

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR002048	164	237	PD000012	Calcium-binding EF-hand
FPrintScan	IPR002167	280	300	PR00928	Graves disease carrier protein
IPR002067	288	301	PR00926	Mitochondrial carrier protein
IPR002067	301	315	PR00926	Mitochondrial carrier protein
IPR002167	305	325	PR00928	Graves disease carrier protein
IPR002067	344	364	PR00926	Mitochondrial carrier protein
IPR002167	363	387	PR00928	Graves disease carrier protein
IPR002067	392	410	PR00926	Mitochondrial carrier protein
IPR002167	415	436	PR00928	Graves disease carrier protein
IPR002067	435	453	PR00926	Mitochondrial carrier protein
IPR002067	483	505	PR00926	Mitochondrial carrier protein
HMMPfam	IPR002048	138	166	PF00036	Calcium-binding EF-hand
IPR002048	169	197	PF00036	Calcium-binding EF-hand
IPR001993	284	374	PF00153	Mitochondrial substrate carrier
IPR001993	378	467	PF00153	Mitochondrial substrate carrier
IPR001993	475	567	PF00153	Mitochondrial substrate carrier
HMMSmart	IPR002048	138	166	SM00054	Calcium-binding EF-hand
IPR002048	169	197	SM00054	Calcium-binding EF-hand
ProfileScan	IPR002048	134	164	PS50222	Calcium-binding EF-hand
IPR002048	165	200	PS50222	Calcium-binding EF-hand
IPR002048	225	248	PS50222	Calcium-binding EF-hand
IPR001993	283	369	PS50920	Mitochondrial substrate carrier
IPR001993	377	462	PS50920	Mitochondrial substrate carrier
IPR001993	474	562	PS50920	Mitochondrial substrate carrier

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGCAACAACATGGGCATCGT

Primer_r
: ATTTGATGGCTGATTCGGGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1800 bp
Genome contig ID	gi89161216f_129793564
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAAAGCAGCCTTCTAATAAAGTTGTTTCAAAGCTG
Flanking genome sequence (117782 - 117831)	----+--------+--------+--------+--------+----* ATCATGGAGCCAGTATTTTTCTGACGGGGGCCTGGGTGGTCTGGGGGTGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	129893564	129911344	11	99.1	Perfect prediction

Primer_f	: CAGCAACAACATGGGCATCGT
Primer_r	: ATTTGATGGCTGATTCGGGGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1896

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information