HUGE

Gene/Protein Characteristic Table for KIAA1886

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07432
Accession No. :	AB067473
Description :	Zinc finger MIZ domain-containing protein 2.
HUGO Gene Name :	zinc finger, MIZ-type containing 2 (ZMIZ2)
Clone Name :	fk01837 [Vector Info]
Flexi ORF Clone :	pF1KSDA1886
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 2883 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 913 bp

Genome contig ID gi89161213f_44664135
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTGAAGAATTAGTACAGCTGTGTTTTTTAAAGCC
Flanking genome sequence
(110527 - 110576)
----+----*----+----*----+----*----+----*----+----*
ACCTCTCTGTCTCCACCCCATGGGCCCACACCCAGGTGGGGGAGGAGGAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 44764135 44774660 13 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 655 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAR85526	1.2e-202	100.0	PIAS-like prote...	Homo sapiens
AAI10436	2.8e-202	99.8	ZMIZ2 protein [...	Homo sapiens
NP_777589	2.9e-202	99.8	zinc finger, MI...	Homo sapiens
XP_001147090	7.8e-202	99.4	hypothetical pr...	Pan troglodytes
XP_001147613	8.1e-202	99.4	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB033050	1.1e-61	62.2	KIAA1224

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004181 331 380 PF02891 Zinc finger

ProfileScan IPR004181 320 397 PS51044 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004181	331	380	PF02891	Zinc finger
ProfileScan	IPR004181	320	397	PS51044	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTTGTCCAGCATTGATCCTTC

Primer_r
: GAGAGGAACCTGACACCACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	913 bp
Genome contig ID	gi89161213f_44664135
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTGAAGAATTAGTACAGCTGTGTTTTTTAAAGCC
Flanking genome sequence (110527 - 110576)	----+--------+--------+--------+--------+----* ACCTCTCTGTCTCCACCCCATGGGCCCACACCCAGGTGGGGGAGGAGGAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	44764135	44774660	13	99.9	Perfect prediction

Primer_f	: CTTGTCCAGCATTGATCCTTC
Primer_r	: GAGAGGAACCTGACACCACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1886

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information