HUGE

Gene/Protein Characteristic Table for KIAA1224

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07431
Accession No. :	AB033050
Description :	Zinc finger MIZ domain-containing protein 1.
HUGO Gene Name :	zinc finger, MIZ-type containing 1 (ZMIZ1)
Clone Name :	fh02652 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh03906, former representative clones for KIAA1224 with fh02652. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 4860 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1865 bp

Genome contig ID gi89161187f_80573431
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTGTGAATATTTTAGTATCGTCTTTGATAATATT
Flanking genome sequence None

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 80673431 80744470 20 99.6 Terminal No-hit

Features of the protein sequence	Description

Length: 997 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9ULJ6	100.0	Zinc finger MIZ...	Homo sapiens
XP_001090830	99.9	similar to reti...	Macaca mulatta
XP_521521	99.9	retinoic acid i...	Pan troglodytes
EAW54639	99.4	retinoic acid i...	Homo sapiens
XP_001929466	99.3	zinc finger, MI...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067473	1.7e-52	62.2	KIAA1886

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004181 668 717 PF02891 Zinc finger

ProfileScan IPR004181 657 734 PS51044 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004181	668	717	PF02891	Zinc finger
ProfileScan	IPR004181	657	734	PS51044	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCACCCCATGCAGGAAACTAT

Primer_r
: CTCCCTACCCCTCTGTTCTGA

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1865 bp
Genome contig ID	gi89161187f_80573431
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTGTGAATATTTTAGTATCGTCTTTGATAATATT
Flanking genome sequence	None

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	80673431	80744470	20	99.6	Terminal No-hit

Primer_f	: CCACCCCATGCAGGAAACTAT
Primer_r	: CTCCCTACCCCTCTGTTCTGA
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1224

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information