| HUGE |
Gene/Protein Characteristic Table for KIAA1866 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00290 |
|---|---|
| Accession No. : | AB058769 |
| Description : | Fibronectin type III domain-containing protein 1. |
| HUGO Gene Name : | fibronectin type III domain containing 1 (FNDC1) |
| Clone Name : | pf09734 [Vector Info] |
| Flexi ORF Clone : | pF1KA1866
|
| Source : | Human brain (hippocampus) |
| Note : | We replaced fj14461, former representative clones for KIAA1866 with pf09734. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6016 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 663 bp Genome contig ID gi89161210f_159438467 PolyA signal sequence
(ATTAAA,-31)
ATTGATTAAAATTGCTAAATTTGTACTTGTTCACCFlanking genome sequence
(174662 - 174711)
AGATAAATGTGTGTGGGAATTTTTGGGCAAAAGTATTGTGTATTAACATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 159538467 159613127 21 99.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1783 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|
Experimental conditions
| : AACAACCACAGTCCGAACCAC | |
| : TCATCTTCTTCAGCGTAGCAC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 6 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
