HUGE

Gene/Protein Characteristic Table for KIAA1839

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK02057
Accession No. :	AB058742
Description :	Alpha-amylase 2B precursor.
HUGO Gene Name :	RNA-binding region (RNP1, RRM) containing 3 (RNPC3)
Clone Name :	fh00676 [Vector Info]
Flexi ORF Clone :	pF1KA1839
Source :	Human fetal brain
Note :	We replaced fj11961, former representative clones for KIAA1839 with fh00676. (2001/6/05)

Features of the cloned DNA sequence	Description

Length: 5385 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3615 bp

Genome contig ID gi89161185f_103740929
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
TAAATTATAAAATTTAAAATTAAATGCATATCCTC
Flanking genome sequence
(182743 - 182792)
----+----*----+----*----+----*----+----*----+----*
AAAACAATAGCCAAGTGTGTTTCTTTTCTTACATATACAGTAATACTTAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 103840929 103923670 17 100.0 Internal No-hit

Features of the protein sequence	Description

Length: 541 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q96LT9	5e-184	100.0	RNA-binding pro...	Homo sapiens
BAF82533	4.4e-183	99.8	unnamed protein...	Homo sapiens
Q5R6C7	5e-183	99.2	RNA-binding pro...	Pongo abelii
Q3MHP0	1.5e-171	93.2	RNA-binding pro...	Bos taurus
XP_547257	3.2e-171	92.5	similar to RNA-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 53 121 PF00076 RNA recognition motif

IPR000504 446 522 PF00076 RNA recognition motif

HMMSmart IPR000504 52 122 SM00360 RNA recognition motif

IPR000504 445 523 SM00360 RNA recognition motif

ProfileScan IPR000504 51 126 PS50102 RNA recognition motif

IPR000504 444 527 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	53	121	PF00076	RNA recognition motif
IPR000504	446	522	PF00076	RNA recognition motif
HMMSmart	IPR000504	52	122	SM00360	RNA recognition motif
IPR000504	445	523	SM00360	RNA recognition motif
ProfileScan	IPR000504	51	126	PS50102	RNA recognition motif
IPR000504	444	527	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3615 bp
Genome contig ID	gi89161185f_103740929
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- TAAATTATAAAATTTAAAATTAAATGCATATCCTC
Flanking genome sequence (182743 - 182792)	----+--------+--------+--------+--------+----* AAAACAATAGCCAAGTGTGTTTCTTTTCTTACATATACAGTAATACTTAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	103840929	103923670	17	100.0	Internal No-hit

Gene/Protein Characteristic Table for KIAA1839

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information