HUGE

Gene/Protein Characteristic Table for KIAA1795

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00280
Accession No. :	AB058698
Description :	Ligand-dependent corepressor.
HUGO Gene Name :	ligand dependent nuclear receptor corepressor (LCOR)
Clone Name :	fj17734 [Vector Info]
Flexi ORF Clone :	pF1KA1795
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4747 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2969 bp

Genome contig ID gi89161187f_98482789
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGCTAGTGGTCCCTTTTGAATTTCATGAGCCTCTC
Flanking genome sequence
(225851 - 225900)
----+----*----+----*----+----*----+----*----+----*
AAAAAAGAAAAACTTAAAAAAAAAAAAAAAAAAAAACAAAAAGCTGCTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 10 f 98582789 98708638 8 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 572 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_543946	2.4e-199	99.3	similar to liga...	Canis lupus fam...
XP_001093998	7.2e-190	98.7	similar to liga...	Macaca mulatta
XP_345034	6.4e-188	93.9	similar to Mblk...	Rattus norvegicus
XP_001054322	6.8e-188	93.9	similar to Mblk...	Rattus norvegicus
Q96JN0	1.5e-157	100.0	Ligand-dependen...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007889 489 534 PF05225 Helix-turn-helix

ProfileScan IPR011526 479 531 PS50960 Helix-turn-helix

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007889	489	534	PF05225	Helix-turn-helix
ProfileScan	IPR011526	479	531	PS50960	Helix-turn-helix

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGGGAAGGTTTTGGACACTC

Primer_r
: ACTCGTAATGTGGTTTTGCCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 10

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGGTCCAGATATTTCCAAGG
Primer_r	: GGAACCCACACCCAAGCTATG
PCR product length	: 171 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2969 bp
Genome contig ID	gi89161187f_98482789
PolyA signal sequence (None)	+--------+--------+----*----+---- AGCTAGTGGTCCCTTTTGAATTTCATGAGCCTCTC
Flanking genome sequence (225851 - 225900)	----+--------+--------+--------+--------+----* AAAAAAGAAAAACTTAAAAAAAAAAAAAAAAAAAAACAAAAAGCTGCTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	10	f	98582789	98708638	8	100.0	Perfect prediction

Primer_f	: CAGGGAAGGTTTTGGACACTC
Primer_r	: ACTCGTAATGTGGTTTTGCCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1795

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information