ROUGE |
Gene/Protein Characteristic Table for mKIAA1795 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129442 |
---|---|
Mblk1-related protein-2. transcription factor MLR2. |
|
mpg00446 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4564 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2966 bp Genome contig ID gi65553144f_40972932 PolyA signal sequence
(None) +----*----+----*----+----*----+----
AGATAGTGGCCCCTTTTAAAATTCATGAGCCTCTCFlanking genome sequence
(133689 - 133738) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAACTTAAAAAAATACAAAAGCTGCTGAATATTTCAAA
KIAA Alignment based on: KIAA1795 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..1598
Length: 531 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |