| HUGE |
Gene/Protein Characteristic Table for KIAA1778 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00914 |
|---|---|
| Accession No. : | AF359381 |
| Description : | BTB/POZ domain-containing protein KCTD12. |
| HUGO Gene Name : | potassium channel tetramerisation domain containing 12 (KCTD12) |
| Clone Name : | pg00707 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1778
![]() |
| Source : | Human brain (hippocampus) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6216 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 4996 bp Genome contig ID gi51511729r_76252313 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
AATTAAACACTAAAGAATAAAACATTCACTCCTTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATTATTCCTCTTGGCTCCTTGGCATGGATTGGCTTGAACACTGGTCTAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 r 76352313 76358526 1 99.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 341 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : | |
| : | |
| : °C |
RH mapping information |
Description | |
|---|---|---|
| : 13 |
| : genbank | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |