HUGE

Gene/Protein Characteristic Table for KIAA1757

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB051544
Description :	SET domain-containing protein 5.
HUGO Gene Name :
Clone Name :	fh19225 [Vector Info]
Flexi ORF Clone :	pF1KA1757
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5768 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 368 bp

Genome contig ID gi89161205f_9350677
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTCACTTGTGCAGTGAGGACATCTTTTTAAATTT
Flanking genome sequence
(142468 - 142517)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAGTTTTCAAAGGAAAAAAAGTTAAAAGAGCCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 9450677 9493143 19 99.9 Terminal No-hit

Features of the protein sequence	Description

Length: 1409 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9C0A6	98.7	SET domain-cont...	Homo sapiens
XP_850775	94.9	similar to myel...	Canis lupus fam...
XP_533749	94.9	similar to myel...	Canis lupus fam...
XP_001495486	94.4	SET domain cont...	Equus caballus
AAH83184	93.7	Setd5 protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001214 234 364 PF00856 SET

HMMSmart IPR001214 239 363 SM00317 SET

ProfileScan IPR001214 253 361 PS50280 SET

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001214	234	364	PF00856	SET
HMMSmart	IPR001214	239	363	SM00317	SET
ProfileScan	IPR001214	253	361	PS50280	SET

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTGGTGGACAAGAAACAAGAC

Primer_r
: AACTCATTGCACTTAGAACCG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	368 bp
Genome contig ID	gi89161205f_9350677
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTCACTTGTGCAGTGAGGACATCTTTTTAAATTT
Flanking genome sequence (142468 - 142517)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAGTTTTCAAAGGAAAAAAAGTTAAAAGAGCCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	9450677	9493143	19	99.9	Terminal No-hit

Primer_f	: CTGGTGGACAAGAAACAAGAC
Primer_r	: AACTCATTGCACTTAGAACCG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1757

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information