| HUGE |
Gene/Protein Characteristic Table for KIAA1738 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Mapping | |
| Product ID : | ORK01179 |
|---|---|
| Accession No. : | AB051525 |
| Description : | Testis-expressed sequence 2 protein. |
| HUGO Gene Name : | testis expressed 2 (TEX2) |
| Clone Name : | pj00192s1 [Vector Info] |
| Flexi ORF Clone : | pF1KA1738
![]() |
| Source : | Human brain (hippocampus) |
| Note : | We replaced pj00192, former representative clones for KIAA1738 with pj00192s1. (2001/2/07) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4914 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1530 bp Genome contig ID gi51511734r_59478531 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
CATTGTTTCACAAAATAAATATCTCAATGTCAAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACTAGATAAGCATCTAAGTCATTTCTACGGAATCCTGTTCAGATAGGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 59578531 59645309 11 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1127 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : unigene | |
| : - | |
| : - | |
| : - | |
| : - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |