ROUGE |
Gene/Protein Characteristic Table for mKIAA1738 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129434 |
---|---|
testis expressed gene 2. | |
mpm05100 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4933 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1448 bp Genome contig ID gi65527427r_106223237 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
CACTTGCATTGTCTCACAAAATAAATATTCATGTCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACACCAGACAAGCATGTTATTTTTTAGAGAAACCCACAGGACCGTGAA
KIAA Alignment based on: KIAA1738 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 81..3485
Length: 1134 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |