HUGE

Gene/Protein Characteristic Table for KIAA1722

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00901
Accession No. :	AB051509
Description :	Glucocorticoid receptor DNA-binding factor 1.
HUGO Gene Name :
Clone Name :	pf00674s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA1722
Source :	Human brain (hippocampus)
Note :	We replaced pf00674, former representative clones for KIAA1722 with pf00674s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7692 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3192 bp

Genome contig ID gi42406306f_52013773
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGTTTCTGTCGCGGGTCCGGTGGGGGCGCGGCCGC
Flanking genome sequence
(185633 - 185682)
----+----*----+----*----+----*----+----*----+----*
GGTGCGGTCGGTGCAGCGTGGCCAATGCGCGGCGCGCGCGGGGGACAGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 52113773 52199404 7 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1499 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW57451	100.0	glucocorticoid ...	Homo sapiens
XP_001112719	99.7	similar to gluc...	Macaca mulatta
Q9NRY4	99.9	Glucocorticoid ...	Homo sapiens
P83509	98.8	Glucocorticoid ...	Canis lupus fam...
XP_593095	98.1	similar to gluc...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040934	8.4e-10	27.5	KIAA1501
AB014572	5.8e-09	28.7	KIAA0672
AB037845	1.1e-08	27.6	KIAA1424
AB014521	1.1e-07	28.3	KIAA0621
AB007871	2.8e-07	30.9	KIAA0411

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013753 212 249 PF00071 Ras

IPR002713 487 547 PF01846 FF

IPR000198 1262 1413 PF00620 RhoGAP

HMMSmart IPR002713 270 327 SM00441 FF

IPR002713 369 422 SM00441 FF

IPR002713 429 483 SM00441 FF

IPR002713 485 539 SM00441 FF

IPR000198 1259 1433 SM00324 RhoGAP

ProfileScan IPR000198 1249 1436 PS50238 RhoGAP

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013753	212	249	PF00071	Ras
IPR002713	487	547	PF01846	FF
IPR000198	1262	1413	PF00620	RhoGAP
HMMSmart	IPR002713	270	327	SM00441	FF
IPR002713	369	422	SM00441	FF
IPR002713	429	483	SM00441	FF
IPR002713	485	539	SM00441	FF
IPR000198	1259	1433	SM00324	RhoGAP
ProfileScan	IPR000198	1249	1436	PS50238	RhoGAP

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTTATGAACTGGAGCTGGATG

Primer_r
: GTCTCCTTTGTTGGGTGGTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3192 bp
Genome contig ID	gi42406306f_52013773
PolyA signal sequence (None)	+--------+--------+----*----+---- AGTTTCTGTCGCGGGTCCGGTGGGGGCGCGGCCGC
Flanking genome sequence (185633 - 185682)	----+--------+--------+--------+--------+----* GGTGCGGTCGGTGCAGCGTGGCCAATGCGCGGCGCGCGCGGGGGACAGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	52113773	52199404	7	99.5	Perfect prediction

Primer_f	: TTTATGAACTGGAGCTGGATG
Primer_r	: GTCTCCTTTGTTGGGTGGTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1722

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information