HUGE

Gene/Protein Characteristic Table for KIAA1685

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00266
Accession No. :	AB051472
Description :	additional sex combs like 2.
HUGO Gene Name :	additional sex combs like 2 (Drosophila) (ASXL2)
Clone Name :	pf04287 [Vector Info]
Flexi ORF Clone :	pF1KA1685
Source :	Human brain (hippocampus)
Note :	We replaced fh25856, former representative clones for KIAA1685 with pf04287. (2001/2/07)

Features of the cloned DNA sequence	Description

Length: 7174 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2645 bp

Genome contig ID gi89161199r_25715757
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAGCCATTCATCTTAAAAGCTGAACAGAAAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACACATTACAATCTGGCCTTTTAGAAAATGAAGCAGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 25815757 25954816 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1505 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_515337	99.3	additional sex ...	Pan troglodytes
Q76L83	100.0	Putative Polyco...	Homo sapiens
CAI45930	99.9	hypothetical pr...	Homo sapiens
BAD00088	99.9	chimeric MOZ-AS...	Homo sapiens
XP_001084149	96.7	similar to addi...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023195	6.6e-13	28.3	KIAA0978

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2645 bp
Genome contig ID	gi89161199r_25715757
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAGCCATTCATCTTAAAAGCTGAACAGAAAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACACATTACAATCTGGCCTTTTAGAAAATGAAGCAGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	25815757	25954816	12	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1685

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information