HUGE

Gene/Protein Characteristic Table for KIAA0978

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04195
Accession No. :	AB023195
Description :	Putative Polycomb group protein ASXL1.
HUGO Gene Name :	additional sex combs like 1 (Drosophila) (ASXL1)
Clone Name :	fg02182 [Vector Info]
Source :	Human fetal brain
Note :	We replaced hj07040, former representative clones for KIAA0978 with fg02182. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6088 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1980 bp

Genome contig ID gi51511747f_30380849
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTGTGGTATTGGAACAATAAACCCGTACAACCTGC
Flanking genome sequence
(109935 - 109984)
----+----*----+----*----+----*----+----*----+----*
AGTTGTGGTCTCAGTCATCTGTGGCTGCCTCGCTGGTGTGGGAAGGTCAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 30480849 30490782 7 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 1368 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW76377	100.0	additional sex ...	Homo sapiens
BAD00087	100.0	polycomb group ...	Homo sapiens
EAW76378	100.0	additional sex ...	Homo sapiens
Q8IXJ9	100.0	Putative Polyco...	Homo sapiens
CAD27708	99.9	additional sex ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051472	3.4e-17	28.3	KIAA1685
AB051500	2.2e-07	24.0	KIAA1713

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAGTTGGGAATGATGTGGTG

Primer_r
: TGTCCCCAAAGGTTCCAGCAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1980 bp
Genome contig ID	gi51511747f_30380849
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTGGTATTGGAACAATAAACCCGTACAACCTGC
Flanking genome sequence (109935 - 109984)	----+--------+--------+--------+--------+----* AGTTGTGGTCTCAGTCATCTGTGGCTGCCTCGCTGGTGTGGGAAGGTCAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	30480849	30490782	7	99.2	Perfect prediction

Primer_f	: CAAGTTGGGAATGATGTGGTG
Primer_r	: TGTCCCCAAAGGTTCCAGCAG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0978

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information