HUGE

Gene/Protein Characteristic Table for KIAA1673

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00263
Accession No. :	AB051460
Description :	Cytoplasmic polyadenylation element-binding protein 4.
HUGO Gene Name :	cytoplasmic polyadenylation element binding protein 4 (CPEB4)
Clone Name :	fg00690 [Vector Info]
Flexi ORF Clone :	pF1KA1673
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6380 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4173 bp

Genome contig ID gi51511721f_173149285
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TGTGAGATGTTGAATGAATAAAACTTTTAACTCAG
Flanking genome sequence
(170635 - 170684)
----+----*----+----*----+----*----+----*----+----*
ATTTCTTTTAATATACTTATTTCTTTTTAACACAAGTAGATGATGCTTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 173249275 173319918 9 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 712 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001097943	99.9	similar to cyto...	Macaca mulatta
XP_866373	99.6	similar to cyto...	Canis lupus fam...
CAI24338	98.3	cytoplasmic pol...	Mus musculus
AAI43960	98.9	Unknown (protei...	Homo sapiens
XP_866358	98.5	similar to cyto...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023157	2.6e-59	60.1	KIAA0940

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000504 457 518 PF00076 RNA recognition motif

HMMSmart IPR000504 456 528 SM00360 RNA recognition motif

IPR000504 564 637 SM00360 RNA recognition motif

ProfileScan IPR000504 455 542 PS50102 RNA recognition motif

IPR000504 563 641 PS50102 RNA recognition motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	457	518	PF00076	RNA recognition motif
HMMSmart	IPR000504	456	528	SM00360	RNA recognition motif
IPR000504	564	637	SM00360	RNA recognition motif
ProfileScan	IPR000504	455	542	PS50102	RNA recognition motif
IPR000504	563	641	PS50102	RNA recognition motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAACATAGAAAGGGAGCTGC

Primer_r
: GTAGGAACAGCACGATAGCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: CCR
Primer_f	: CAAACATAGAAAGGGAGCTGC
Primer_r	: GTAGGAACAGCACGATAGCAC
PCR product length	: 209 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4173 bp
Genome contig ID	gi51511721f_173149285
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TGTGAGATGTTGAATGAATAAAACTTTTAACTCAG
Flanking genome sequence (170635 - 170684)	----+--------+--------+--------+--------+----* ATTTCTTTTAATATACTTATTTCTTTTTAACACAAGTAGATGATGCTTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	173249275	173319918	9	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1673

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information