HUGE

Gene/Protein Characteristic Table for KIAA1665

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00883
Accession No. :	AB051452
Description :	DNA-directed RNA polymerase III subunit RPC8.
HUGO Gene Name :	polymerase (RNA) III (DNA directed) polypeptide H (22.9kD) (POLR3H)
Clone Name :	hk01809 [Vector Info]
Flexi ORF Clone :	pF1KSDA1665
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4311 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3453 bp

Genome contig ID gi89161203r_40151776
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
CCTTAATAAGCAGCATAAATAAATATCTGACACAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTGGAGGCCTCTGGCCACACCAAAAAGGCTTGTTTTTGGTCGGTGCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 40251776 40270294 6 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 217 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9Y535	3.3e-92	100.0	DNA-directed RN...	Homo sapiens
BAE88415	4.8e-91	99.5	unnamed protein...	Macaca fascicularis
Q9D2C6	5e-90	98.0	DNA-directed RN...	Mus musculus
BAE31279	2.2e-89	97.5	unnamed protein...	Mus musculus
XP_001502570	2.6e-89	97.1	similar to poly...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005576 21 90 PF03876 RNA polymerase Rpb7

IPR013238 92 214 PF08292 RNA polymerase III

ScanRegExp IPR003006 85 91 PS00290 Immunoglobulin/major histocompatibility complex motif

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005576	21	90	PF03876	RNA polymerase Rpb7
IPR013238	92	214	PF08292	RNA polymerase III
ScanRegExp	IPR003006	85	91	PS00290	Immunoglobulin/major histocompatibility complex motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3453 bp
Genome contig ID	gi89161203r_40151776
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- CCTTAATAAGCAGCATAAATAAATATCTGACACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTGGAGGCCTCTGGCCACACCAAAAAGGCTTGTTTTTGGTCGGTGCCAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	40251776	40270294	6	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA1665

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information