HUGE |
Gene/Protein Characteristic Table for KIAA1663 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00882 |
---|---|
Accession No. : | AB051450 |
Description : | Protein Tob2. |
HUGO Gene Name : | |
Clone Name : | hk01115 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1663 |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4314 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2813 bp Genome contig ID gi89161203r_40059448 PolyA signal sequence
(ATTAAA,-18) +----*----+----*----+----*----+----
GATTTTTTTAAGTTTGTATTAAAAGCATGATACATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AATAGCCTTCTGCCTGCTCCTGGCTTGCTTGGTTTCTGGGGTCCCTTTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 r 40159448 40172732 2 99.1 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 347 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 22 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |