ROUGE |
Gene/Protein Characteristic Table for mKIAA1663 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122537 |
---|---|
Tob2 protein. | |
mbg02432 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5198 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2458 bp Genome contig ID gi65543215r_81798988 PolyA signal sequence
(ATTAAA,-24) +----*----+----*----+----*----+----
TTTAAGTTTGTATTAAAAGCATGATATATAATAGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CTTCTGCCTACTTGTTTGTGTTTCTGGGGTCCCTTTGAGATGGCCCCTTC
KIAA Alignment based on: KIAA1663 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1694..2740
Length: 348 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |