HUGE

Gene/Protein Characteristic Table for KIAA1656

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05691
Accession No. :	AB051443
Description :
HUGO Gene Name :
Clone Name :	fg00806 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 6970 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5576 bp

Genome contig ID gi89161203r_28994800
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AGGAGTATTATAATAAAAAGCTAAGTTTGCATTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CATGGGAACCAAGCTGTTTTAAAGAAGTATTGTGTTTACAACACATACCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 29094800 29101772 1 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 136 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAG30233	2.6e-60	100.0	Em:AC004997.11 ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	5576 bp
Genome contig ID	gi89161203r_28994800
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AGGAGTATTATAATAAAAAGCTAAGTTTGCATTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATGGGAACCAAGCTGTTTTAAAGAAGTATTGTGTTTACAACACATACCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	29094800	29101772	1	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1656

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information