ROUGE

Gene/Protein Characteristic Table for mKIAA1656

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220409
Description :
Clone Name :	mfj12037 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4263 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1695 bp

Genome contig ID gi65527427r_3937156
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CAGCCAGAGCCACTTACAAACCCTGTCTCAAAAAG
Flanking genome sequence
(99626 - 99577)
----+----*----+----*----+----*----+----*----+----*
AAAAAGAGAAAGAAATGGAGGGTGTGCAGCAGACAATGTGTGTCCTGTAT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1656 DNA sequence, AA sequence

KIAA	Alignment based on:
KIAA1656	DNA sequence, AA sequence

Features of the protein sequence	Description

Coding region: 586..2565
Length: 660 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAE21539	2.6e-174	100.0	unnamed protein...	Mus musculus
AAI20740	4.6e-169	100.0	RIKEN cDNA 4930...	Mus musculus
BAC36532	6.3e-169	99.8	unnamed protein...	Mus musculus
EDL40463	7.5e-166	98.7	RIKEN cDNA 4930...	Mus musculus
XP_001062582	2.8e-161	92.3	hypothetical pr...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan NULL 259 574 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	NULL	259	574	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1695 bp
Genome contig ID	gi65527427r_3937156
PolyA signal sequence (None)	+--------+--------+----*----+---- CAGCCAGAGCCACTTACAAACCCTGTCTCAAAAAG
Flanking genome sequence (99626 - 99577)	----+--------+--------+--------+--------+----* AAAAAGAGAAAGAAATGGAGGGTGTGCAGCAGACAATGTGTGTCCTGTAT

Gene/Protein Characteristic Table for mKIAA1656

Features of the cloned DNA sequence

Features of the protein sequence