HUGE

Gene/Protein Characteristic Table for KIAA1585

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00870
Accession No. :	AB046805
Description :	ring finger protein 184.
HUGO Gene Name :	male-specific lethal 2 homolog (Drosophila) (MSL2)
Clone Name :	fj07340 [Vector Info]
Flexi ORF Clone :	pF1KSDA1585
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4039 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2224 bp

Genome contig ID gi89161205r_137250450
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTAAATCTATCAATAAATGATAGTTTTCTAATTCT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTTGTAGAATACTGAAGAGTTTGGGATAGCATGCTCTGAATGGTCTGT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 137350450 137396726 2 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 595 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_542793	98.8	similar to ring...	Canis lupus fam...
XP_236567	98.5	similar to ring...	Rattus norvegicus
Q9HCI7	100.0	Male-specific l...	Homo sapiens
BAF85246	99.7	unnamed protein...	Homo sapiens
XP_001927797	99.1	similar to Male...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ProfileScan IPR001841 62 103 PS50089 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
ProfileScan	IPR001841	62	103	PS50089	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGGACTGACTAGGTGTAATG

Primer_r
: GGCGAGTAACCATCATTGAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: RH-map
Primer_f	: AAGGACTGACTAGGTGTAATG
Primer_r	: GGCGAGTAACCATCATTGAAC
PCR product length	: 194 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2224 bp
Genome contig ID	gi89161205r_137250450
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTAAATCTATCAATAAATGATAGTTTTCTAATTCT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTTGTAGAATACTGAAGAGTTTGGGATAGCATGCTCTGAATGGTCTGT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	137350450	137396726	2	99.1	Perfect prediction

Gene/Protein Characteristic Table for KIAA1585

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information