HUGE

Gene/Protein Characteristic Table for KIAA1567

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04871
Accession No. :	AB046787
Description :	Eukaryotic translation initiation factor 2C 4.
HUGO Gene Name :	eukaryotic translation initiation factor 2C, 4 (EIF2C4)
Clone Name :	fh22119 [Vector Info]
Flexi ORF Clone :	pF1KA1567
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5990 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3214 bp

Genome contig ID gi89161185f_35955069
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CTCCAGCCTGGGCAACAAGAGCGAAACTCTGTCTC
Flanking genome sequence
(139940 - 139989)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAGGGGGGGGGGGGACATTAAGAGAGTGGTGATGACCCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 36046415 36095007 18 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 924 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAC26738	95.8	unnamed protein...	Mus musculus
XP_524663	95.3	eukaryotic tran...	Pan troglodytes
Q9HCK5	100.0	Eukaryotic tran...	Homo sapiens
XP_606455	99.5	similar to euka...	Bos taurus
AAH96023	98.8	Eukaryotic tran...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR014811 228 280 PF08699 Domain of unknown function DUF1785

IPR003100 288 424 PF02170 Argonaute and Dicer protein

IPR003165 572 883 PF02171 Stem cell self-renewal protein Piwi

ProfileScan IPR003100 288 401 PS50821 Argonaute and Dicer protein

IPR003165 572 883 PS50822 Stem cell self-renewal protein Piwi

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR014811	228	280	PF08699	Domain of unknown function DUF1785
IPR003100	288	424	PF02170	Argonaute and Dicer protein
IPR003165	572	883	PF02171	Stem cell self-renewal protein Piwi
ProfileScan	IPR003100	288	401	PS50821	Argonaute and Dicer protein
IPR003165	572	883	PS50822	Stem cell self-renewal protein Piwi

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTCTCTATCCAGGACATCAGG

Primer_r
: ATTTCCCCACCAGCAGTTTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: CCR
Primer_f	: TTCTCTATCCAGGACATCAGG
Primer_r	: ATTTCCCCACCAGCAGTTTCC
PCR product length	: 157 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3214 bp
Genome contig ID	gi89161185f_35955069
PolyA signal sequence (None)	+--------+--------+----*----+---- CTCCAGCCTGGGCAACAAGAGCGAAACTCTGTCTC
Flanking genome sequence (139940 - 139989)	----+--------+--------+--------+--------+----* AAAAAAAAAAAGGGGGGGGGGGGACATTAAGAGAGTGGTGATGACCCAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	36046415	36095007	18	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA1567

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information