| HUGE |
Gene/Protein Characteristic Table for KIAA1529 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | |
|---|---|
| Accession No. : | AB040962 |
| Description : | |
| HUGO Gene Name : | |
| Clone Name : | hh04104 [Vector Info] |
| Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5752 bp
|
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
| cloned DNA seq. | Warning for N-terminal truncation: NO | NO | Warning for coding interruption: YES | YES | |
Length of 3'UTR 393 bp Genome contig ID gi89161216f_98940600 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
ATTTTAATTTAACAGAATAAACAAGTATGGGTTATFlanking genome sequence
(238792 - 238841) ----+----*----+----*----+----*----+----*----+----*
AATTGCAACTCTGCACTGGTTCCTAGACCCAACAAATAACTAATCCAATG
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 99040600 99179390 48 99.7 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1680 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR-ELISA | Description |
|---|

Experimental conditions
| : ACTATCCAAGGCCTGTATGTG | |
| : ATGGACGGAAAGTAGGTAGGC | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 9 |
| : GeneBridge 4 | |
| : ACTATCCAAGGCCTGTATGTG | |
| : ATGGACGGAAAGTAGGTAGGC | |
| : 106 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage
| |