HUGE

Gene/Protein Characteristic Table for KIAA1525

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK01173
Accession No. :	AB040958
Description :	BTB/POZ domain-containing protein 7.
HUGO Gene Name :
Clone Name :	fj15588 [Vector Info]
Flexi ORF Clone :	pF1KA1525
Source :	Human fetal brain
Note :	We replaced fj01939, former representative clones for KIAA1525 with fj15588. (2001/2/22)

Features of the cloned DNA sequence	Description

Length: 4818 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1111 bp

Genome contig ID gi51511730r_92677550
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GTGCTCCCACCTGGGCAACAGTGAGACCCTGTCTC
Flanking genome sequence
(99713 - 99664)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGGCAGTGGAAATAGAGAAGTAACTTAAAGGTCACA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 92777263 92869120 11 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1135 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P203	100.0	BTB/POZ domain-...	Homo sapiens
XP_001150552	99.6	BTB (POZ) domai...	Pan troglodytes
XP_547956	96.5	similar to BTB ...	Canis lupus fam...
XP_001927139	96.0	BTB (POZ) domai...	Sus scrofa
XP_001497701	94.9	BTB (POZ) domai...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013069 135 241 PF00651 BTB/POZ

IPR013069 243 400 PF00651 BTB/POZ

IPR011705 421 481 PF07707 BTB/Kelch-associated

HMMSmart IPR000210 145 247 SM00225 BTB/POZ-like

IPR000210 250 400 SM00225 BTB/POZ-like

ProfileScan IPR000210 145 214 PS50097 BTB/POZ-like

IPR000210 250 344 PS50097 BTB/POZ-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	135	241	PF00651	BTB/POZ
IPR013069	243	400	PF00651	BTB/POZ
IPR011705	421	481	PF07707	BTB/Kelch-associated
HMMSmart	IPR000210	145	247	SM00225	BTB/POZ-like
IPR000210	250	400	SM00225	BTB/POZ-like
ProfileScan	IPR000210	145	214	PS50097	BTB/POZ-like
IPR000210	250	344	PS50097	BTB/POZ-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1111 bp
Genome contig ID	gi51511730r_92677550
PolyA signal sequence (None)	+--------+--------+----*----+---- GTGCTCCCACCTGGGCAACAGTGAGACCCTGTCTC
Flanking genome sequence (99713 - 99664)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGGCAGTGGAAATAGAGAAGTAACTTAAAGGTCACA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	92777263	92869120	11	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1525

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information