ROUGE |
Gene/Protein Characteristic Table for mKIAA1525 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122522 |
---|---|
BTB (POZ) domain containing 7. | |
mbg05802 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6888 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 5090 bp Genome contig ID gi65532617r_98149435 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CTACAATTGGGCTGGGTCCTCCCATATCAATCATCFlanking genome sequence
(99425 - 99376) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAGAGAGAGAGAGAGAAGAAAAAGCCCAAT
KIAA Alignment based on: KIAA1525 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 92..1798
Length: 568 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |