HUGE |
Gene/Protein Characteristic Table for KIAA1521 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00243 |
---|---|
Accession No. : | AB040954 |
Description : | GTPase activating protein and VPS9 domains 1. |
HUGO Gene Name : | GTPase activating protein and VPS9 domains 1 (GAPVD1) |
Clone Name : | ha02560 [Vector Info] |
Flexi ORF Clone : | pF1KA1521 |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced fh14406 and fj01708, former representative clones for KIAA1521 with ha02560. (2002/5/10,2007/1/24) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5309 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 582 bp Genome contig ID gi89161216f_126963968 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TCTGCAGATTCTAATAAACAAGGACTATTGCTGATFlanking genome sequence
(201462 - 201511) ----+----*----+----*----+----*----+----*----+----*
AGTAGGCTGTGACATACTGTCTTGTGAAATGGTTTCCTTGACAAAATTTA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 127063968 127165428 28 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1484 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 9 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |