HUGE

Gene/Protein Characteristic Table for KIAA1521

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00243
Accession No. :	AB040954
Description :	GTPase activating protein and VPS9 domains 1.
HUGO Gene Name :	GTPase activating protein and VPS9 domains 1 (GAPVD1)
Clone Name :	ha02560 [Vector Info]
Flexi ORF Clone :	pF1KA1521
Source :	Myeloblast cell line (KG-1)
Note :	We replaced fh14406 and fj01708, former representative clones for KIAA1521 with ha02560. (2002/5/10,2007/1/24)

Features of the cloned DNA sequence	Description

Length: 5309 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 582 bp

Genome contig ID gi89161216f_126963968
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TCTGCAGATTCTAATAAACAAGGACTATTGCTGAT
Flanking genome sequence
(201462 - 201511)
----+----*----+----*----+----*----+----*----+----*
AGTAGGCTGTGACATACTGTCTTGTGAAATGGTTTCCTTGACAAAATTTA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 127063968 127165428 28 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 1484 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q14C86	100.0	GTPase-activati...	Homo sapiens
XP_537846	96.5	similar to GTPa...	Canis lupus fam...
XP_415380	91.1	similar to GTPa...	Gallus gallus
AAI14938	98.8	GAPVD1 protein ...	Homo sapiens
XP_863217	97.7	similar to GTPa...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001936 158 359 PF00616 Ras GTPase-activating protein

IPR003123 1380 1482 PF02204 Vacuolar sorting protein 9

HMMSmart IPR013995 1379 1484 SM00167 Vacuolar sorting protein 9

ProfileScan IPR001936 150 359 PS50018 Ras GTPase-activating protein

IPR003123 1344 1484 PS51205 Vacuolar sorting protein 9

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001936	158	359	PF00616	Ras GTPase-activating protein
IPR003123	1380	1482	PF02204	Vacuolar sorting protein 9
HMMSmart	IPR013995	1379	1484	SM00167	Vacuolar sorting protein 9
ProfileScan	IPR001936	150	359	PS50018	Ras GTPase-activating protein
IPR003123	1344	1484	PS51205	Vacuolar sorting protein 9

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	582 bp
Genome contig ID	gi89161216f_126963968
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCTGCAGATTCTAATAAACAAGGACTATTGCTGAT
Flanking genome sequence (201462 - 201511)	----+--------+--------+--------+--------+----* AGTAGGCTGTGACATACTGTCTTGTGAAATGGTTTCCTTGACAAAATTTA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	127063968	127165428	28	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1521

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information