HUGE

Gene/Protein Characteristic Table for KIAA1513

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB040946
Description :	Pogo transposable element with KRAB domain.
HUGO Gene Name :	pogo transposable element with KRAB domain (POGK)
Clone Name :	fh00168 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5498 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 3774 bp

Genome contig ID gi89161185f_164975348
PolyA signal sequence
(AAGAAA,-8)
+----*----+----*----+----*----+----
GGTGACAGAGTGAGACCCTATCTCAAAAAGAAAAG
Flanking genome sequence
(116859 - 116908)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGAAATGGCATACCTTAGTTGGAATCTGCTTTTTAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 165075348 165092205 6 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 649 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_547486	94.0	similar to pogo...	Canis lupus fam...
Q9P215	100.0	Pogo transposab...	Homo sapiens
XP_001086831	98.9	similar to pogo...	Macaca mulatta
XP_001490155	96.2	pogo transposab...	Equus caballus
AAI42234	95.6	POGK protein [B...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007930	1.1e-14	24.9	KIAA0461
AB033111	3.3e-08	36.8	KIAA1285
AB011115	1e-06	35.3	KIAA0543
AB007872	3.4e-05	30.6	KIAA0412
AB046808	3.5e-05	24.3	KIAA1588

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001909 87 127 PF01352 KRAB box

IPR015175 293 357 PF09091 Centromere protein B

IPR004875 395 607 PF03184 CENP-B protein

HMMSmart IPR001909 87 147 SM00349 KRAB box

IPR006600 296 363 SM00674 Centromere protein B

ProfileScan IPR003655 84 148 PS50806 KRAB-related

IPR001909 87 158 PS50805 KRAB box

IPR006600 290 363 PS51253 Centromere protein B

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001909	87	127	PF01352	KRAB box
IPR015175	293	357	PF09091	Centromere protein B
IPR004875	395	607	PF03184	CENP-B protein
HMMSmart	IPR001909	87	147	SM00349	KRAB box
IPR006600	296	363	SM00674	Centromere protein B
ProfileScan	IPR003655	84	148	PS50806	KRAB-related
IPR001909	87	158	PS50805	KRAB box
IPR006600	290	363	PS51253	Centromere protein B

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TTGGTGGACAGAGTTCAGATG

Primer_r
: ATAGAATGCTGGAAGACTGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	3774 bp
Genome contig ID	gi89161185f_164975348
PolyA signal sequence (AAGAAA,-8)	+--------+--------+----*----+---- GGTGACAGAGTGAGACCCTATCTCAAAAAGAAAAG
Flanking genome sequence (116859 - 116908)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGAAATGGCATACCTTAGTTGGAATCTGCTTTTTAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	165075348	165092205	6	99.3	Perfect prediction

Primer_f	: TTGGTGGACAGAGTTCAGATG
Primer_r	: ATAGAATGCTGGAAGACTGCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1513

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information