HUGE

Gene/Protein Characteristic Table for KIAA0412

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00070
Accession No. :	AB007872
Description :	Zinc finger protein 264.
HUGO Gene Name :	zinc finger protein 264 (ZNF264)
Clone Name :	hg03242 [Vector Info]
Flexi ORF Clone :	pF1KA0412
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6530 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4283 bp

Genome contig ID gi42406306f_62294731
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGCCTGGGCAACAGAGCGAGACTCCATCTC
Flanking genome sequence
(127608 - 127657)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAATTCTCTAGCTCTCTATGCCTTGTTGTATCCTCAGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 62394731 62422337 5 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 720 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
O43296	100.0	Zinc finger pro...	Homo sapiens
AAI15412	99.7	ZNF264 protein ...	Homo sapiens
NP_001018857	85.5	zinc finger pro...	Homo sapiens
XP_001492137	86.2	similar to Zinc...	Equus caballus
Q5CZA5	85.7	Zinc finger pro...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046831	1.6e-63	44.5	KIAA1611
AB075836	1.6e-63	41.9	KIAA1956
AB018341	5e-63	42.9	KIAA0798
AB075827	5.4e-62	44.3	KIAA1947
D31763	4.6e-61	40.1	KIAA0065

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR007087 324 347 PD000003 Zinc finger

IPR007087 352 375 PD000003 Zinc finger

IPR007087 380 403 PD000003 Zinc finger

IPR007087 436 459 PD000003 Zinc finger

IPR007087 464 487 PD000003 Zinc finger

IPR007087 492 515 PD000003 Zinc finger

IPR007087 520 543 PD000003 Zinc finger

IPR007087 548 571 PD000003 Zinc finger

IPR007087 576 599 PD000003 Zinc finger

IPR007087 604 627 PD000003 Zinc finger

IPR007087 632 655 PD000003 Zinc finger

HMMPfam IPR001909 107 147 PF01352 KRAB box

IPR007087 296 318 PF00096 Zinc finger

IPR007087 324 346 PF00096 Zinc finger

IPR007087 352 374 PF00096 Zinc finger

IPR007087 380 402 PF00096 Zinc finger

IPR007087 408 430 PF00096 Zinc finger

IPR007087 436 458 PF00096 Zinc finger

IPR007087 464 486 PF00096 Zinc finger

IPR007087 492 514 PF00096 Zinc finger

IPR007087 520 542 PF00096 Zinc finger

IPR007087 548 570 PF00096 Zinc finger

IPR007087 576 598 PF00096 Zinc finger

IPR007087 604 626 PF00096 Zinc finger

IPR007087 632 654 PF00096 Zinc finger

HMMSmart IPR001909 107 167 SM00349 KRAB box

IPR015880 296 318 SM00355 Zinc finger

IPR015880 324 346 SM00355 Zinc finger

IPR015880 352 374 SM00355 Zinc finger

IPR015880 380 402 SM00355 Zinc finger

IPR015880 408 430 SM00355 Zinc finger

IPR015880 436 458 SM00355 Zinc finger

IPR015880 464 486 SM00355 Zinc finger

IPR015880 492 514 SM00355 Zinc finger

IPR015880 520 542 SM00355 Zinc finger

IPR015880 548 570 SM00355 Zinc finger

IPR015880 576 598 SM00355 Zinc finger

IPR015880 604 626 SM00355 Zinc finger

IPR015880 632 654 SM00355 Zinc finger

ProfileScan IPR001909 107 178 PS50805 KRAB box

IPR007087 296 323 PS50157 Zinc finger

IPR007087 324 351 PS50157 Zinc finger

IPR007087 352 379 PS50157 Zinc finger

IPR007087 380 407 PS50157 Zinc finger

IPR007087 408 435 PS50157 Zinc finger

IPR007087 436 463 PS50157 Zinc finger

IPR007087 464 491 PS50157 Zinc finger

IPR007087 492 519 PS50157 Zinc finger

IPR007087 520 547 PS50157 Zinc finger

IPR007087 548 575 PS50157 Zinc finger

IPR007087 576 603 PS50157 Zinc finger

IPR007087 604 631 PS50157 Zinc finger

IPR007087 632 659 PS50157 Zinc finger

ScanRegExp IPR007087 298 318 PS00028 Zinc finger

IPR007087 326 346 PS00028 Zinc finger

IPR007087 354 374 PS00028 Zinc finger

IPR007087 382 402 PS00028 Zinc finger

IPR007087 410 430 PS00028 Zinc finger

IPR007087 438 458 PS00028 Zinc finger

IPR007087 466 486 PS00028 Zinc finger

IPR007087 494 514 PS00028 Zinc finger

IPR007087 522 542 PS00028 Zinc finger

IPR007087 550 570 PS00028 Zinc finger

IPR007087 578 598 PS00028 Zinc finger

IPR007087 606 626 PS00028 Zinc finger

IPR007087 634 654 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	324	347	PD000003	Zinc finger
IPR007087	352	375	PD000003	Zinc finger
IPR007087	380	403	PD000003	Zinc finger
IPR007087	436	459	PD000003	Zinc finger
IPR007087	464	487	PD000003	Zinc finger
IPR007087	492	515	PD000003	Zinc finger
IPR007087	520	543	PD000003	Zinc finger
IPR007087	548	571	PD000003	Zinc finger
IPR007087	576	599	PD000003	Zinc finger
IPR007087	604	627	PD000003	Zinc finger
IPR007087	632	655	PD000003	Zinc finger
HMMPfam	IPR001909	107	147	PF01352	KRAB box
IPR007087	296	318	PF00096	Zinc finger
IPR007087	324	346	PF00096	Zinc finger
IPR007087	352	374	PF00096	Zinc finger
IPR007087	380	402	PF00096	Zinc finger
IPR007087	408	430	PF00096	Zinc finger
IPR007087	436	458	PF00096	Zinc finger
IPR007087	464	486	PF00096	Zinc finger
IPR007087	492	514	PF00096	Zinc finger
IPR007087	520	542	PF00096	Zinc finger
IPR007087	548	570	PF00096	Zinc finger
IPR007087	576	598	PF00096	Zinc finger
IPR007087	604	626	PF00096	Zinc finger
IPR007087	632	654	PF00096	Zinc finger
HMMSmart	IPR001909	107	167	SM00349	KRAB box
IPR015880	296	318	SM00355	Zinc finger
IPR015880	324	346	SM00355	Zinc finger
IPR015880	352	374	SM00355	Zinc finger
IPR015880	380	402	SM00355	Zinc finger
IPR015880	408	430	SM00355	Zinc finger
IPR015880	436	458	SM00355	Zinc finger
IPR015880	464	486	SM00355	Zinc finger
IPR015880	492	514	SM00355	Zinc finger
IPR015880	520	542	SM00355	Zinc finger
IPR015880	548	570	SM00355	Zinc finger
IPR015880	576	598	SM00355	Zinc finger
IPR015880	604	626	SM00355	Zinc finger
IPR015880	632	654	SM00355	Zinc finger
ProfileScan	IPR001909	107	178	PS50805	KRAB box
IPR007087	296	323	PS50157	Zinc finger
IPR007087	324	351	PS50157	Zinc finger
IPR007087	352	379	PS50157	Zinc finger
IPR007087	380	407	PS50157	Zinc finger
IPR007087	408	435	PS50157	Zinc finger
IPR007087	436	463	PS50157	Zinc finger
IPR007087	464	491	PS50157	Zinc finger
IPR007087	492	519	PS50157	Zinc finger
IPR007087	520	547	PS50157	Zinc finger
IPR007087	548	575	PS50157	Zinc finger
IPR007087	576	603	PS50157	Zinc finger
IPR007087	604	631	PS50157	Zinc finger
IPR007087	632	659	PS50157	Zinc finger
ScanRegExp	IPR007087	298	318	PS00028	Zinc finger
IPR007087	326	346	PS00028	Zinc finger
IPR007087	354	374	PS00028	Zinc finger
IPR007087	382	402	PS00028	Zinc finger
IPR007087	410	430	PS00028	Zinc finger
IPR007087	438	458	PS00028	Zinc finger
IPR007087	466	486	PS00028	Zinc finger
IPR007087	494	514	PS00028	Zinc finger
IPR007087	522	542	PS00028	Zinc finger
IPR007087	550	570	PS00028	Zinc finger
IPR007087	578	598	PS00028	Zinc finger
IPR007087	606	626	PS00028	Zinc finger
IPR007087	634	654	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAGAGAGCTAGGGAATTTTAC

Primer_r
: AAATGTTAAACTATCTGGGGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAGAGAGCTAGGGAATTTTAC
Primer_r	: AAATGTTAAACTATCTGGGGG
PCR product length	: 155 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	4283 bp
Genome contig ID	gi42406306f_62294731
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAACAGAGCGAGACTCCATCTC
Flanking genome sequence (127608 - 127657)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAATTCTCTAGCTCTCTATGCCTTGTTGTATCCTCAGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	62394731	62422337	5	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0412

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information