HUGE |
Gene/Protein Characteristic Table for KIAA1507 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05666 |
---|---|
Accession No. : | AB040940 |
Description : | up-regulated gene 4 isoform 2. |
HUGO Gene Name : | |
Clone Name : | hk04967 [Vector Info] |
Flexi ORF Clone : | pF1KA1507
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4360 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 773 bp Genome contig ID gi89161213r_43782269 PolyA signal sequence
(AATGAA,-25) +----*----+----*----+----*----+----
ATGTCTGTTAAATGAATGAGTGCACAAGTGATGGTFlanking genome sequence
(99749 - 99700) ----+----*----+----*----+----*----+----*----+----*
AATGGGCAGGTTCTGCCTCTCTGTGCCTTAATTCTCCTGTTTCTCAAAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 7 r 43882018 43912435 7 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 872 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGTGAGTGTGCAGAGAAACCC | |
: AACTGCTGCTTGTCTCCCTAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 7 |
: GeneBridge 4 | |
: TATAGCTGCTCTCTGTCACTG | |
: ATCTTGAATGCTGGTCCACTG | |
: 171 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |