HUGE

Gene/Protein Characteristic Table for KIAA1475

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK02035
Accession No. :	AB040908
Description :	Vacuolar protein sorting-associated protein 18 homolog.
HUGO Gene Name :	vacuolar protein sorting 18 homolog (S. cerevisiae) (VPS18)
Clone Name :	fj03454 [Vector Info]
Flexi ORF Clone :	pF1KA1475
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3869 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 633 bp

Genome contig ID gi51511731f_38873945
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
GATGGAGGTGGAGAGCATTAAACTGTCTGCACTGC
Flanking genome sequence
(109521 - 109570)
----+----*----+----*----+----*----+----*----+----*
ACTGGTGGCTTTGTGTCGATGCTGGGCCGAGCGGTGTGTGAGTGATCTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 38973945 38983464 5 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 986 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P253	100.0	Vacuolar protei...	Homo sapiens
XP_523187	99.7	vacuolar protei...	Pan troglodytes
XP_001099146	99.7	similar to vacu...	Macaca mulatta
XP_544627	97.4	similar to vacu...	Canis lupus fam...
XP_001503547	97.5	similar to LOC5...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007810 304 449 PF05131 Pep3/Vps18/deep orange

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007810	304	449	PF05131	Pep3/Vps18/deep orange

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTTCCGTCTGTTCACTCTGC

Primer_r
: TCACCCAATGCCCAGGACTTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	633 bp
Genome contig ID	gi51511731f_38873945
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- GATGGAGGTGGAGAGCATTAAACTGTCTGCACTGC
Flanking genome sequence (109521 - 109570)	----+--------+--------+--------+--------+----* ACTGGTGGCTTTGTGTCGATGCTGGGCCGAGCGGTGTGTGAGTGATCTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	38973945	38983464	5	100.0	Perfect prediction

Primer_f	: TCTTCCGTCTGTTCACTCTGC
Primer_r	: TCACCCAATGCCCAGGACTTC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1475

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information