HUGE

Gene/Protein Characteristic Table for KIAA1457

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01169
Accession No. :	AB040890
Description :	Membrane-associated phosphatidylinositol transfer protein 2.
HUGO Gene Name :
Clone Name :	fh16161s1 [Vector Info]
Flexi ORF Clone :	pF1KA1457
Source :	Human fetal brain
Note :	We replaced fh16161, former representative clones for KIAA1457 with fh16161s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 6799 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2546 bp

Genome contig ID gi89161190r_121933981
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
TGTCTGTTACACCAATTAAAGAAGCGGGAAGGCTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CCTTCTGGATCTCTTTACTGCAGTGGCGACCGTGGGGCATGGTGGGATGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 122033981 122160996 25 99.5 Terminal No-hit

Features of the protein sequence	Description

Length: 1359 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW98384	100.0	phosphatidylino...	Homo sapiens
XP_001100098	98.3	similar to phos...	Macaca mulatta
Q9BZ72	92.6	Membrane-associ...	Homo sapiens
XP_001100187	91.1	similar to phos...	Macaca mulatta
Q6ZPQ6	83.5	Membrane-associ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051492	0.00073	22.8	KIAA1705

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001666 32 51 PR00391 Phosphatidylinositol transfer protein

IPR001666 101 121 PR00391 Phosphatidylinositol transfer protein

IPR001666 127 142 PR00391 Phosphatidylinositol transfer protein

IPR001666 214 229 PR00391 Phosphatidylinositol transfer protein

IPR001666 235 254 PR00391 Phosphatidylinositol transfer protein

HMMPfam IPR001666 17 269 PF02121 Phosphatidylinositol transfer protein

IPR004177 731 973 PF02862 DDHD

IPR013209 1118 1249 PF08235 LNS2

HMMSmart IPR013209 1118 1249 SM00775 LNS2

ProfileScan IPR004177 731 973 PS51043 DDHD

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001666	32	51	PR00391	Phosphatidylinositol transfer protein
IPR001666	101	121	PR00391	Phosphatidylinositol transfer protein
IPR001666	127	142	PR00391	Phosphatidylinositol transfer protein
IPR001666	214	229	PR00391	Phosphatidylinositol transfer protein
IPR001666	235	254	PR00391	Phosphatidylinositol transfer protein
HMMPfam	IPR001666	17	269	PF02121	Phosphatidylinositol transfer protein
IPR004177	731	973	PF02862	DDHD
IPR013209	1118	1249	PF08235	LNS2
HMMSmart	IPR013209	1118	1249	SM00775	LNS2
ProfileScan	IPR004177	731	973	PS51043	DDHD

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CCCTCCACACTGAAAACACCC

Primer_r
: TCGGCATGAAAACGGAATTGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCTCCACACTGAAAACACCC
Primer_r	: TCGGCATGAAAACGGAATTGG
PCR product length	: 196 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2546 bp
Genome contig ID	gi89161190r_121933981
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- TGTCTGTTACACCAATTAAAGAAGCGGGAAGGCTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CCTTCTGGATCTCTTTACTGCAGTGGCGACCGTGGGGCATGGTGGGATGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	122033981	122160996	25	99.5	Terminal No-hit

Gene/Protein Characteristic Table for KIAA1457

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information