HUGE

Gene/Protein Characteristic Table for KIAA1705

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04721
Accession No. :	AB051492
Description :	Probable phospholipase DDHD1.
HUGO Gene Name :	DDHD domain containing 1 (DDHD1)
Clone Name :	fj17028 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 3949 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 739 bp

Genome contig ID gi51511730r_52482495
PolyA signal sequence
(ATTAAA,-21)
+----*----+----*----+----*----+----
ATACATTTTTTTTCATTAAAAACTTATGGCTTCAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACAACACTAGTTCAATTTTTTAAATAAACTTTTTATTATGTTACATGTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 r 52582495 52630132 9 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 498 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_509953	5.3e-201	99.8	DDHD domain con...	Pan troglodytes
EAW80622	5.9e-201	99.8	DDHD domain con...	Homo sapiens
XP_001160034	6e-201	99.8	DDHD domain con...	Pan troglodytes
EAW80623	6e-201	99.8	DDHD domain con...	Homo sapiens
XP_001159988	6e-201	99.8	DDHD domain con...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018268	2.4e-10	27.8	KIAA0725
AB040890	1.3e-05	22.8	KIAA1457

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004177 237 484 PF02862 DDHD

ProfileScan IPR004177 237 484 PS51043 DDHD

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004177	237	484	PF02862	DDHD
ProfileScan	IPR004177	237	484	PS51043	DDHD

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGAGAATCAAGCAAGACCTGG

Primer_r
: AGAATATGCTGAACCTTGACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	739 bp
Genome contig ID	gi51511730r_52482495
PolyA signal sequence (ATTAAA,-21)	+--------+--------+----*----+---- ATACATTTTTTTTCATTAAAAACTTATGGCTTCAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACAACACTAGTTCAATTTTTTAAATAAACTTTTTATTATGTTACATGTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	r	52582495	52630132	9	99.2	Perfect prediction

Primer_f	: AGAGAATCAAGCAAGACCTGG
Primer_r	: AGAATATGCTGAACCTTGACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1705

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information