HUGE

Gene/Protein Characteristic Table for KIAA1454

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06732
Accession No. :	AB040887
Description :	Zinc finger protein 291.
HUGO Gene Name :
Clone Name :	fh15916 [Vector Info]
Flexi ORF Clone :	pF1KA1454
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5438 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1639 bp

Genome contig ID gi51511731r_74359119
PolyA signal sequence
(ATTAAA,-17)
+----*----+----*----+----*----+----
ATAATGTCAAGTGATTTCATTAAAAAAGGAAAAAG
Flanking genome sequence
(99986 - 99937)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAGGAAAAGAAAAAAATCAAAAAGAAAAATCAAAAGCCTATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 r 74459105 74984799 27 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 1265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001147278	99.1	zinc finger pro...	Pan troglodytes
BAG10459	99.2	zinc finger pro...	synthetic construct
Q9BY12	99.1	S phase cyclin ...	Homo sapiens
EAW99218	99.1	zinc finger pro...	Homo sapiens
XP_523229	98.6	zinc finger pro...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR003604 810 844 SM00451 Zinc finger

ScanRegExp IPR007087 815 837 PS00028 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR003604	810	844	SM00451	Zinc finger
ScanRegExp	IPR007087	815	837	PS00028	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CTAGGATAAGTCAGCTGTTCG

Primer_r
: TGGTGCGCCTTTGTGAGTGAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTAGGATAAGTCAGCTGTTCG
Primer_r	: TGGTGCGCCTTTGTGAGTGAG
PCR product length	: 118 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1639 bp
Genome contig ID	gi51511731r_74359119
PolyA signal sequence (ATTAAA,-17)	+--------+--------+----*----+---- ATAATGTCAAGTGATTTCATTAAAAAAGGAAAAAG
Flanking genome sequence (99986 - 99937)	----+--------+--------+--------+--------+----* AAAAAAAAAAGGAAAAGAAAAAAATCAAAAAGAAAAATCAAAAGCCTATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	r	74459105	74984799	27	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA1454

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information