HUGE

Gene/Protein Characteristic Table for KIAA1452

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK06428
Accession No. :	AB040885
Description :	DNA-directed RNA polymerase III subunit RPC5.
HUGO Gene Name :
Clone Name :	fh12994 [Vector Info]
Flexi ORF Clone :	pF1KA1452
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4800 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2714 bp

Genome contig ID gi51511732f_22116277
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
GACTGGGCGACAGAGCAAGACTGTGTCTCAGAAAG
Flanking genome sequence
(131638 - 131687)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAACATAGATTCAGTTCTGTTCAGTAGGTATGCGGTACT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 16 f 22216277 22247913 18 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 694 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW50606	100.0	polymerase (RNA...	Homo sapiens
XP_511201	96.5	hypothetical pr...	Pan troglodytes
AAH00285	100.0	POLR3E protein ...	Homo sapiens
Q9NVU0	100.0	DNA-directed RN...	Homo sapiens
AAM18215	99.8	RNA polymerase ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006886 44 474 PF04801 Sin-like protein conserved region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006886	44	474	PF04801	Sin-like protein conserved region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGCAGCCACACATTTCAGATT

Primer_r
: ATGATTCTGATGGAGCTGGCT

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 16

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCTGGGCTGCTTTTCTGTCAC
Primer_r	: CCCATTTTGCTGCCAGGTCTG
PCR product length	: 167 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2714 bp
Genome contig ID	gi51511732f_22116277
PolyA signal sequence (None)	+--------+--------+----*----+---- GACTGGGCGACAGAGCAAGACTGTGTCTCAGAAAG
Flanking genome sequence (131638 - 131687)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAACATAGATTCAGTTCTGTTCAGTAGGTATGCGGTACT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	16	f	22216277	22247913	18	99.3	Perfect prediction

Primer_f	: TGCAGCCACACATTTCAGATT
Primer_r	: ATGATTCTGATGGAGCTGGCT
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1452

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information