HUGE

Gene/Protein Characteristic Table for KIAA1428

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04145
Accession No. :	AB037849
Description :	DCC-interacting protein 13 alpha.
HUGO Gene Name :
Clone Name :	fh02979s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh02979, former representative clones for KIAA1428 with fh02979s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5901 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3771 bp

Genome contig ID gi89161205f_57136952
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TAATGTATAATAAAGTCCATGATTTTTGTACAGTG
Flanking genome sequence
(145576 - 145625)
----+----*----+----*----+----*----+----*----+----*
TTTTTTAATGAAATATTTGATACTCTGAACTTTATTTCTCAAAGTAATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 f 57236952 57282526 22 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 709 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_849075	98.3	similar to DCC-...	Canis lupus fam...
Q8K3H0	98.0	DCC-interacting...	Mus musculus
XP_516550	100.0	adaptor protein...	Pan troglodytes
AAI42496	97.7	APPL1 protein [...	Bos taurus
ACH47027	97.3	adaptor protein...	Sus scrofa

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051503	1.7e-12	24.1	KIAA1716
D26069	6.1e-11	23.2	KIAA0041
AB007860	7.4e-05	22.2	KIAA0400
D30758	0.00071	20.8	KIAA0050

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 278 375 PF00169 Pleckstrin-like

IPR006020 502 633 PF00640 Phosphotyrosine interaction region

HMMSmart IPR001849 278 377 SM00233 Pleckstrin-like

IPR006020 497 636 SM00462 Phosphotyrosine interaction region

ProfileScan IPR001849 277 375 PS50003 Pleckstrin-like

IPR006020 502 638 PS01179 Phosphotyrosine interaction region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	278	375	PF00169	Pleckstrin-like
IPR006020	502	633	PF00640	Phosphotyrosine interaction region
HMMSmart	IPR001849	278	377	SM00233	Pleckstrin-like
IPR006020	497	636	SM00462	Phosphotyrosine interaction region
ProfileScan	IPR001849	277	375	PS50003	Pleckstrin-like
IPR006020	502	638	PS01179	Phosphotyrosine interaction region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GTTTGTTGTCCTTAGCAGTAG

Primer_r
: GTTACCTTCTGCCATTTCACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3771 bp
Genome contig ID	gi89161205f_57136952
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TAATGTATAATAAAGTCCATGATTTTTGTACAGTG
Flanking genome sequence (145576 - 145625)	----+--------+--------+--------+--------+----* TTTTTTAATGAAATATTTGATACTCTGAACTTTATTTCTCAAAGTAATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	f	57236952	57282526	22	99.3	Perfect prediction

Primer_f	: GTTTGTTGTCCTTAGCAGTAG
Primer_r	: GTTACCTTCTGCCATTTCACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1428

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information