HUGE

Gene/Protein Characteristic Table for KIAA1369

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00817
Accession No. :	AB037790
Description :	Eukaryotic translation initiation factor 2-alpha kinase 1.
HUGO Gene Name :	eukaryotic translation initiation factor 2-alpha kinase 1 (EIF2AK1)
Clone Name :	fj03222 [Vector Info]
Flexi ORF Clone :	pF1KSDA1369
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4391 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2427 bp

Genome contig ID gi89161213r_5928624
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTCTTACAATAAACTTGAGAAAATGTTAAGAAAAT
Flanking genome sequence
(99782 - 99733)
----+----*----+----*----+----*----+----*----+----*
AATAAGGATGCTGGGCATGGTGGCTCACACCTGTAGTCCCTGCTGCTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 6028406 6065311 15 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 653 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9BQI3	100.0	Eukaryotic tran...	Homo sapiens
AAQ02401	100.0	heme-regulated ...	synthetic construct
BAC11461	99.8	unnamed protein...	Homo sapiens
AAF18391	99.7	heme-regulated ...	Homo sapiens
CAB66498	99.8	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029024	8.8e-08	31.3	KIAA1101
AB037759	1.6e-06	33.9	KIAA1338

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 190 263 PD000001 Protein kinase

IPR000719 442 597 PD000001 Protein kinase

HMMPfam IPR000719 190 606 PF00069 Protein kinase

HMMSmart IPR001245 190 606 SM00219 Tyrosine protein kinase

IPR002290 190 606 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 190 606 PS50011 Protein kinase

ScanRegExp IPR000719 196 220 PS00107 Protein kinase

IPR008271 461 473 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	190	263	PD000001	Protein kinase
IPR000719	442	597	PD000001	Protein kinase
HMMPfam	IPR000719	190	606	PF00069	Protein kinase
HMMSmart	IPR001245	190	606	SM00219	Tyrosine protein kinase
IPR002290	190	606	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	190	606	PS50011	Protein kinase
ScanRegExp	IPR000719	196	220	PS00107	Protein kinase
IPR008271	461	473	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCTTTGCGTTGCTTCATCTC

Primer_r
: ATGGTTTTGATAAGAGGCAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2427 bp
Genome contig ID	gi89161213r_5928624
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTCTTACAATAAACTTGAGAAAATGTTAAGAAAAT
Flanking genome sequence (99782 - 99733)	----+--------+--------+--------+--------+----* AATAAGGATGCTGGGCATGGTGGCTCACACCTGTAGTCCCTGCTGCTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	6028406	6065311	15	99.4	Perfect prediction

Primer_f	: ATCTTTGCGTTGCTTCATCTC
Primer_r	: ATGGTTTTGATAAGAGGCAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1369

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information