HUGE

Gene/Protein Characteristic Table for KIAA1338

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04865
Accession No. :	AB037759
Description :	Eukaryotic translation initiation factor 2-alpha kinase 4.
HUGO Gene Name :	eukaryotic translation initiation factor 2 alpha kinase 4 (EIF2AK4)
Clone Name :	fh16948 [Vector Info]
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4994 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 506 bp

Genome contig ID gi51511731f_37935111
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
ATTTATCTTTTGGGATATAATAAATGCTTTCATAT
Flanking genome sequence
(179974 - 180023)
----+----*----+----*----+----*----+----*----+----*
ACCTGCTGCTTTTTAATTGTAAATCTATTAACACTAAAGGTTTTAGGGAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 38033407 38115083 35 99.8 Terminal No-hit

Features of the protein sequence	Description

Length: 1495 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2K8	100.0	Eukaryotic tran...	Homo sapiens
XP_001140245	99.9	eukaryotic tran...	Pan troglodytes
AAI46320	99.9	Eukaryotic tran...	synthetic construct
XP_001501317	94.0	similar to Euka...	Equus caballus
XP_001139259	97.4	eukaryotic tran...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037790	1.2e-05	33.9	KIAA1369

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000719 196 295 PD000001 Protein kinase

IPR000719 436 506 PD000001 Protein kinase

IPR000719 642 838 PD000001 Protein kinase

HMMPfam IPR000719 178 289 PF00069 Protein kinase

IPR000719 436 847 PF00069 Protein kinase

IPR002314 909 1069 PF00587 Aminoacyl-tRNA synthetase

HMMSmart IPR002290 132 385 SM00220 Serine/threonine protein kinase

IPR001245 436 847 SM00219 Tyrosine protein kinase

IPR002290 436 847 SM00220 Serine/threonine protein kinase

ProfileScan IPR000719 142 385 PS50011 Protein kinase

IPR000719 436 847 PS50011 Protein kinase

ScanRegExp IPR000719 442 465 PS00107 Protein kinase

IPR006172 533 541 PS00116 DNA-directed DNA polymerase B

IPR008271 690 702 PS00108 Serine/threonine protein kinase

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	196	295	PD000001	Protein kinase
IPR000719	436	506	PD000001	Protein kinase
IPR000719	642	838	PD000001	Protein kinase
HMMPfam	IPR000719	178	289	PF00069	Protein kinase
IPR000719	436	847	PF00069	Protein kinase
IPR002314	909	1069	PF00587	Aminoacyl-tRNA synthetase
HMMSmart	IPR002290	132	385	SM00220	Serine/threonine protein kinase
IPR001245	436	847	SM00219	Tyrosine protein kinase
IPR002290	436	847	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	142	385	PS50011	Protein kinase
IPR000719	436	847	PS50011	Protein kinase
ScanRegExp	IPR000719	442	465	PS00107	Protein kinase
IPR006172	533	541	PS00116	DNA-directed DNA polymerase B
IPR008271	690	702	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAAAGGAATGGCAGAGAAGC

Primer_r
: GTCTGAAGTCGAGTTTGTACC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	506 bp
Genome contig ID	gi51511731f_37935111
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ATTTATCTTTTGGGATATAATAAATGCTTTCATAT
Flanking genome sequence (179974 - 180023)	----+--------+--------+--------+--------+----* ACCTGCTGCTTTTTAATTGTAAATCTATTAACACTAAAGGTTTTAGGGAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	38033407	38115083	35	99.8	Terminal No-hit

Primer_f	: TGAAAGGAATGGCAGAGAAGC
Primer_r	: GTCTGAAGTCGAGTTTGTACC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1338

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information