HUGE

Gene/Protein Characteristic Table for KIAA1345

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00809
Accession No. :	AB037766
Description :
HUGO Gene Name :	coiled-coil and C2 domain containing 2A (CC2D2A)
Clone Name :	fj00488 [Vector Info]
Flexi ORF Clone :	pF1KSDA1345
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4790 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 121 bp

Genome contig ID gi89161207f_14989945
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CATATTATTGGCAAATAATAAAATTATCAACTGTT
Flanking genome sequence
(222324 - 222373)
----+----*----+----*----+----*----+----*----+----*
TTCAAACTGTGCAAAGTGTTCTATTTAGCAGTCTGCCTTGTGTCTGCTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 15089945 15212267 34 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1532 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9P2K1	99.9	Coiled-coil and...	Homo sapiens
EAW92732	99.9	hCG40571, isofo...	Homo sapiens
XP_001118936	96.8	similar to CG18...	Macaca mulatta
XP_001500688	89.3	coiled-coil and...	Equus caballus
XP_595408	84.9	similar to coil...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR000008 1013 1173 SM00239 C2 calcium-dependent membrane targeting

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR000008	1013	1173	SM00239	C2 calcium-dependent membrane targeting

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AGTGAAGCCTTTAATTGACGC

Primer_r
: GCAACATAGATCCAAACAGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	121 bp
Genome contig ID	gi89161207f_14989945
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CATATTATTGGCAAATAATAAAATTATCAACTGTT
Flanking genome sequence (222324 - 222373)	----+--------+--------+--------+--------+----* TTCAAACTGTGCAAAGTGTTCTATTTAGCAGTCTGCCTTGTGTCTGCTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	15089945	15212267	34	99.9	Perfect prediction

Primer_f	: AGTGAAGCCTTTAATTGACGC
Primer_r	: GCAACATAGATCCAAACAGAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1345

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information