HUGE

Gene/Protein Characteristic Table for KIAA1325

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00803
Accession No. :	AB037746
Description :	LRP2 binding protein.
HUGO Gene Name :
Clone Name :	fh14327 [Vector Info]
Flexi ORF Clone :	pF1KSDA1325
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 5155 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3299 bp

Genome contig ID gi89161207r_186422027
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
AAAAATAAAGACAATAAAATCTTCACAATAACTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACACAAAGCATTGCATAACAATGTTCTTCAATATACATGAAATAATATAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 186522027 186537146 8 99.1 Perfect prediction

Features of the protein sequence	Description

Length: 354 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9P2M1	1e-148	100.0	LRP2-binding pr...	Homo sapiens
CAB82313	9e-148	99.4	hypothetical pr...	Homo sapiens
XP_001085019	4.3e-143	96.0	similar to LRP2...	Macaca mulatta
Q4R3N2	1.7e-142	95.7	LRP2-binding pr...	Macaca fascicularis
XP_001490987	1.7e-138	92.0	similar to LRP2...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018289	7.2e-06	23.9	KIAA0746
D50931	0.00044	24.7	KIAA0141

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013105 66 99 PF07719 Tetratricopeptide TPR_2

IPR006597 140 175 PF08238 Sel1-like

IPR006597 180 213 PF08238 Sel1-like

IPR006597 214 249 PF08238 Sel1-like

IPR006597 304 339 PF08238 Sel1-like

HMMSmart IPR006597 97 132 SM00671 Sel1-like

IPR006597 140 175 SM00671 Sel1-like

IPR006597 180 213 SM00671 Sel1-like

IPR006597 214 249 SM00671 Sel1-like

IPR006597 304 339 SM00671 Sel1-like

ProfileScan IPR013026 66 99 PS50005 Tetratricopeptide region

IPR013026 66 99 PS50293 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013105	66	99	PF07719	Tetratricopeptide TPR_2
IPR006597	140	175	PF08238	Sel1-like
IPR006597	180	213	PF08238	Sel1-like
IPR006597	214	249	PF08238	Sel1-like
IPR006597	304	339	PF08238	Sel1-like
HMMSmart	IPR006597	97	132	SM00671	Sel1-like
IPR006597	140	175	SM00671	Sel1-like
IPR006597	180	213	SM00671	Sel1-like
IPR006597	214	249	SM00671	Sel1-like
IPR006597	304	339	SM00671	Sel1-like
ProfileScan	IPR013026	66	99	PS50005	Tetratricopeptide region
IPR013026	66	99	PS50293	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACTAAGAACTGTTGAATGGCA

Primer_r
: AAGTGGTTGAAGGAATGTTAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3299 bp
Genome contig ID	gi89161207r_186422027
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AAAAATAAAGACAATAAAATCTTCACAATAACTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACACAAAGCATTGCATAACAATGTTCTTCAATATACATGAAATAATATAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	186522027	186537146	8	99.1	Perfect prediction

Primer_f	: ACTAAGAACTGTTGAATGGCA
Primer_r	: AAGTGGTTGAAGGAATGTTAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1325

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information