HUGE

Gene/Protein Characteristic Table for KIAA0141

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00425
Accession No. :	D50931
Description :
HUGO Gene Name :
Clone Name :	ha03721 [Vector Info]
Flexi ORF Clone :	pF1KSDA0141
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3020 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1392 bp

Genome contig ID gi51511721f_141183611
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
CTAGGTGTTTAATAAAACAGATATTGGATTATCTC
Flanking genome sequence
(116291 - 116340)
----+----*----+----*----+----*----+----*----+----*
ATCACTCTTGCCCTTGAGTATTATGGGAAGAGCCAGGGAGACGGGCAGGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 5 f 141283611 141299900 12 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 536 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAF85558	5.6e-203	99.8	unnamed protein...	Homo sapiens
XP_001091095	3.2e-191	94.0	similar to CG10...	Macaca mulatta
XP_544318	4.3e-160	81.0	similar to CG10...	Canis lupus fam...
EDL76436	1.1e-140	73.7	SEL1 domain con...	Rattus norvegicus
BAE42690	1.1e-137	72.8	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR006597 266 297 PF08238 Sel1-like

IPR006597 298 333 PF08238 Sel1-like

IPR006597 334 371 PF08238 Sel1-like

IPR006597 372 405 PF08238 Sel1-like

IPR006597 406 441 PF08238 Sel1-like

HMMSmart IPR006597 266 297 SM00671 Sel1-like

IPR006597 298 333 SM00671 Sel1-like

IPR006597 334 371 SM00671 Sel1-like

IPR006597 372 405 SM00671 Sel1-like

IPR006597 406 441 SM00671 Sel1-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR006597	266	297	PF08238	Sel1-like
IPR006597	298	333	PF08238	Sel1-like
IPR006597	334	371	PF08238	Sel1-like
IPR006597	372	405	PF08238	Sel1-like
IPR006597	406	441	PF08238	Sel1-like
HMMSmart	IPR006597	266	297	SM00671	Sel1-like
IPR006597	298	333	SM00671	Sel1-like
IPR006597	334	371	SM00671	Sel1-like
IPR006597	372	405	SM00671	Sel1-like
IPR006597	406	441	SM00671	Sel1-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 5

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACAGTCAAGAAGAGGAAAGTG
Primer_r	: GTAGGAGGGCAGACACCATTG
PCR product length	: 140 bp
PCR conditions	: 95 °C15 sec62 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1392 bp
Genome contig ID	gi51511721f_141183611
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- CTAGGTGTTTAATAAAACAGATATTGGATTATCTC
Flanking genome sequence (116291 - 116340)	----+--------+--------+--------+--------+----* ATCACTCTTGCCCTTGAGTATTATGGGAAGAGCCAGGGAGACGGGCAGGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	5	f	141283611	141299900	12	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0141

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information