HUGE |
Gene/Protein Characteristic Table for KIAA1293 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | |
Product ID : | ORK00799 |
---|---|
Accession No. : | D14697 |
Description : | Farnesyl pyrophosphate synthetase. |
HUGO Gene Name : | |
Clone Name : | ha00701 [Vector Info] |
Flexi ORF Clone : | pF1KSDA1293
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 1430 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 56 bp Genome contig ID gi89161185f_153445379 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
GAGAGGAGGCTCTCAATAAATAATCGTGTAACCTTFlanking genome sequence
(111703 - 111752) ----+----*----+----*----+----*----+----*----+----*
CTTGTGGTTCTGTTCTTGCTCGGCCCAGCCAGAGTCTGGCTCTTTCCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 153545379 153557080 11 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 420 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |