| HUGE |
Gene/Protein Characteristic Table for KIAA1293 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | |
| Product ID : | ORK00799 |
|---|---|
| Accession No. : | D14697 |
| Description : | Farnesyl pyrophosphate synthetase. |
| HUGO Gene Name : | |
| Clone Name : | ha00701 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA1293
|
| Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 1430 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 56 bp Genome contig ID gi89161185f_153445379 PolyA signal sequence
(AATAAA,-21)
GAGAGGAGGCTCTCAATAAATAATCGTGTAACCTTFlanking genome sequence
(111703 - 111752)
CTTGTGGTTCTGTTCTTGCTCGGCCCAGCCAGAGTCTGGCTCTTTCCAGA
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 153545379 153557080 11 100.0 Perfect prediction
Features of the protein sequence |
Description | |
|---|---|---|
Length: 420 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000092 | 111 | 383 | PF00348 | Polyprenyl synthetase |
| ScanRegExp | IPR000092 | 167 | 181 | PS00723 | Polyprenyl synthetase |
| IPR000092 | 302 | 314 | PS00444 | Polyprenyl synthetase |
| Method | No. | N terminal | transmembrane region | C terminal | type | length |
|---|---|---|---|---|---|---|
| - | - | - | - | - | - | - |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
