HUGE

Gene/Protein Characteristic Table for KIAA1291

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01157
Accession No. :	AB033117
Description :	Exportin-5.
HUGO Gene Name :	exportin 5 (XPO5)
Clone Name :	fh18869 [Vector Info]
Flexi ORF Clone :	pF1KA1291
Source :	Human fetal brain
Note :	We replaced hj08227, former representative clones for KIAA1291 with fh18869. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5296 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1531 bp

Genome contig ID gi89161210r_43498053
PolyA signal sequence
(AGTAAA,-24)
+----*----+----*----+----*----+----
ATCTGCATGTCAGTAAAAATCTCAGTTTCGTACAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGGGACCCATCTGCCTTTTTCAACCTAGTCTTAAAACCAGTGACATAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 43598053 43651729 32 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1254 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG11300	100.0	exportin-5 [syn...	synthetic construct
Q9HAV4	99.9	Exportin-5; Sho...	Homo sapiens
BAF84141	99.8	unnamed protein...	Homo sapiens
AAG53603	99.8	RANBP21 [Homo s...	Homo sapiens
CAI42640	99.6	exportin 5 [Hom...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR013598 159 321 PF08389 Exportin-1/Importin-beta-like

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013598	159	321	PF08389	Exportin-1/Importin-beta-like

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TACCCTAGATAGTGTCACATG

Primer_r
: ACCTGAAAGACCATGAGATTG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1531 bp
Genome contig ID	gi89161210r_43498053
PolyA signal sequence (AGTAAA,-24)	+--------+--------+----*----+---- ATCTGCATGTCAGTAAAAATCTCAGTTTCGTACAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGGGACCCATCTGCCTTTTTCAACCTAGTCTTAAAACCAGTGACATAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	43598053	43651729	32	99.9	Perfect prediction

Primer_f	: TACCCTAGATAGTGTCACATG
Primer_r	: ACCTGAAAGACCATGAGATTG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1291

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information